Google-Tabs

Mar 2004
31

Heh, ich will die Tabs bei Google wieder haben! Der Weg zu den Groups ist jetzt ein halbes Mauspad länger geworden und ist an dem “neuen Design” irgendwas besser oder alles nur ein bisschen anders?

Two new tower gates will be jordans for sale also constructed for the North and South End Zone, increasing the cost of the redevelopment to around $143 million.Miron Construction of Neenah, Wisconsin will be in charge of the works that will reach as high as the banks of light found at the South End Zone. Top of page Case reportA 22 year old female presented to our department with symptoms of ocular irritation. She was previously fit and well. On examination, visual acuity was 6/5 in both eyes with +1.50 RE and +2.00 LE. External inspection showed anterior blepharitis, consistent with her symptoms. Routine fundoscopy revealed peripapillary myelinated nerve fibres in both eyes. The right was more significantly affected, with myelination of the nasal peripapillary, up to half a disc diameter from the optic nerve margin. The left eye had a small area of myelination on the inferior disc margin (Figure 1). The ophthalmic examination was otherwise unremarkable including normal pupil reactions and full fields. These are up to half the disc diameters in the nasal peripapillary area fake oakleys in the right eye and small area of myelination to the disc in the left eye.This one has to get credit for going above and beyond Young Fritz up there. After all, that Cheap MLB Jerseys kid could have sneaked a cigar out of Old Fritz’s stash without him knowing. But, no, here they’re issuing a clear call to the terrifying old men of the world: “Find a young girl and make her drink beer with you.” Really, the most irresponsible part of NFL Jerseys Cheap the ad is that it doesn’t warn him to hide her revolver first.Develop a concept for your website. There are numerous fantasy football websites. Each has its own unique style and organization. Research the various styles to determine which you think is most effective and professional. Then develop your own vision for a website to make it different from the others. Determine a clear design for the site, including color and layout. Your fantasy football website should be easy to use and attractive to visitors.Subscribe to USA TODAYAlready a print edition subscriber, but don’t have a login?Activate your digital access.Manage your account settings.My AccountLog OutWeek 2 in the NFL is here, and For the Win is making some predictions. And we’re going bold with them1. Blaine Gabbert gets benchedBlaine Gabbert gets benched for Colin Kaepernick and four other bold predictions for Week 2. Attend as many MLB tryout camps as possible. They are held in June and July around the country, are free of charge and are attended by territorial scouts who work for all 30 of the Major League organizations. Pro baseball teams sometimes sign free agents to cheap jordans online fill out their minor league baseball roster when they didn’t sign enough players in the main draft.

CD-Inflation

Mar 2004
30

Achja, vielen Dank übrigens für den Tipp. Hat sofort und ohne Probleme funktioniert und ich hab hier ne Menge neuer CDs rumliegen. So könnte das doch immer sein. 6,99 für ne CD ist einfach ein guter Preis, da würde sich das runterladen ja garnicht mehr lohnen ;-)

Fording a vein of emerald water known as the South Fork of the Eel, they climbed the far bank and entered the translucent shade of the most magnificent grove they seen yet. Redwoods the size of Saturn rockets sprouted from the ground like giant beanstalks, their butts blackened by fire. Some bore thick, ropy bark that spiraled skyward in candy cane swirls. Others had huge cavities known as goose pens the use early pioneers put them to enough to hold 20 people.Logan Ryan was benched after getting roasted up and down the field by Adams in the first quarter and when he did get back in the game, only a brutal drop prevented him from getting beat for a touchdown right off the line of scrimmage. And Patrick Chung, who is having an excellent season, was burned multiple times when attempting to cover tight ends Andrew Quarless and Richard Rodgers. It didn’t help at all that Aaron Rodgers is so good, he’s borderline inhuman. Or that cheap nfl jerseys unlike some of the Pats’ recent opponents, the Packers weren’t afraid to go to their third and even fourth options if need be. But these were still discouraging developments for the defense.Ingesting large amounts of unripe mulberries can cause moderate hallucinations. We at Cracked would totally call dibs on patenting an unripe mulberry jam called “Cosmic Confiture,” but, well, you cheap oakleys know this is going to end badly. This is Cracked, and it’s our job to teach you about all the scary shit in God’s creation.The French Connection is known for having the grandmother of all car chases (the one in Bullitt being the granddaddy) and for making us wonder why there aren’t more famous characters named Popeye. Seriously, just two seems like a damned replica oakleys waste. Anyway, in the film, Gene Hackman plays NYPD detective Popeye Doyle, who in one scene chases an elevated train through the busy streets of New York, running into a few bumps along the way. For example, at one point Doyle’s cheap China Jerseys car crashes with another vehicle .and goes spinning out of control in cheap nhl jerseys the middle of the street:LESSON ONE: It’s a man’s world. In football, girls can’t often play with the boys. There are safety issues that NFL rules are constitutionally incapable of addressing. (These rules have changed more than 40 times since 1876, sometimes to ensure safety as they will with brain injury issues; it’s just too much to figure out how to allow athletic women to play). There are, Cheap NFL Jerseys however, girls and ray bans ale women who play and play well. They have their own teams, and to date, have been most successful when dressed in lingerie. And, while diversity is a recognized issue in all sports, these concerns rarely extend to women. It’s just too much for some people to even consider. Kids aren’t stupid. They’re just small people.

Ultra-Kurztrip

Mar 2004
30

Ein sonniger Tag an der Ostsee, ein Tag in Berlin und 1600km Autobahn, damit wäre der Urlaub für diese Ferien auch erledigt.

actor rob lowe parodies his sex tape scandalThe NBA got so tired of his shenanigans that they made breaking a backboard a finable offense. “Chocolate Thunder” played six seasons in Philly and then departed for the New Jersey Nets. Dawkins narrowly missed out on a championship, as the 76ers won the NBA Finals the next year. Still, he was an undeniable star, as well as was one of those athletes who fake oakleys realizes that, first and foremost, they are entertainers. Dawkins gave himself nicknames such as “Dr. Dunkenstein” and claimed to be from Planet Lovetron. His dunks even had names he attributed to them, including “The Yo Mama” and the “Look Out Below.” Stevie Wonder actually gave him the aforementioned “Chocolate cheap ray bans Thunder” moniker upon meeting him for the first time, so, obviously, Dawkins even inspired awe from people who couldn’t see him.This past fall Yahoo collaborated with the NFL for the first time to live stream an NFL game globally. Recently it was announced that NBC and CBS had won the rights to broadcast Fake Oakleys Thursday night football games wholesale nfl jersyes for the next two years. However, there is one important note in the announcement that shows Yahoo has the potential to build on its experience with the NFL custom jerseys this cheap ray bans past fall. In the announcement, it states, “The league is going to sell streaming rights to the games separately, rather than including them in the deal with CBS and NBC.” I believe Yahoo should make a bid they did last year and bid big! because the NFL is one of the best media properties to have access to. If Yahoo were to win exclusive streaming rights for Thursday night games that would be a big win for Yahoo. As was noted in a Bloomberg article, Yahoo paid $17 million for the rights to stream the game and they noted that Yahoo sold out all of its game day advertisements, which shows the popularity of the NFL. By having a full season of Thursday night football games to stream, Yahoo would attract more eyeballs to its homepage and thus more advertisers, which would help increase ad revenue.We had 6 matches played by each team. Surely we have seen some teams perform in a substantial manner. Although it a little too early to predict the winners as it the premier league and we have just seen Leicester win the previous. The popularity of this game can be estimated from the fact that it is the largest playing game. The Redskins did just enough to win in Philly. And that’s good enough. It’s December. Win and move on.11. The Lions won a nail biter. Again. And for once, Lions fans can’t complain about the whole world being against them. The refs cheap nfl jerseys were very kind to them on the Bears’ last series after, of course, calling a terrible penalty on Detroit in the first half.

Die Mahnung – das unbekannte Wesen – akademie.de (via)

BLEDSOE: You know, one of the most difficult parts of the wine business is dealing with compliance in all the different states. You know, there are 39 other states that have made this happen and it’s gone fake ray bans smoothly. If Massachusetts changes this law, hopefully, you know, the other states will follow suit.”Wait, I’ve watched tennis before and I hear the commentators say things like ‘break point’ and ‘up a break’ and ‘game point’. Seems to be a big deal. What’s alOh, I’m glad you pointed that out. It’s probably one of the most confusing aspects in all of tennis (besides advantage scoring). See, the rules of tennis favor the server (Explaining why is again beyond the scope. Just believe me.), so there is Cheap NFL Jerseys important terminology to signify this. If the server has the score of advantage then the next point is called “game point”. cheap oakleys If the player returning the serve has advantage the next point is called “break point”. The importance of game points and break points leads us to .I watched The Bachelor the other night In my defence there was absolutely nothing to watch on the television and it was the season premiere and oh well, I might as well admit it, I saw the previews and the man in question looks quite disarming. Obviously my curiosity is piqued.As Newt arrives, New York is hit by a series of unexplained disasters houses collapse, cobbled roads are ripped apart, that sort of highly destructive thing. But is it all the fault of the magic animals who have escaped from Fake Oakleys his case, as Macusa’s sinister chief investigator (Colin Farrell) apparently believes? Or might darker forces be to blame, such as those marshalled by the dark wizard Gellert Grindelwald? Don’t worry, it is apparently all right to call this one by name.Remember the fourth quarter of Super Bowl XLII. The New England Patriots were highly favored to win over the New York Giants. However, Eli Manning pass to David Tyree in the final two minutes of Super Bowl XLII was a defining catch. With this catch, David Tyree leaped and pressed the ball against his helmet making a catch so spectacular that it has become known as Helmet Catch. This play was key in the Giants 17 14 upset victory over the New England Patriots.The Colts were in the same position at this stage last year and still managed to reach the AFC Championship game, so all hope is not lost. Cheap NFL Jerseys Still, it makes the challenge of making the wholesale nfl jerseys playoffs that bit more difficult. Take the Seahawks for oakleys outlet example, who are the only team in the NFC West not to have a win and are two wins behind the Cardinals already.
(0)

Quicksilver

Mar 2004
25

OS X Software: Quicksilver. Quicksilver ist ein Launchbar-Ersatz wenn nicht sogar mehr. Ich hab das Ding gestern mal ausprobiert und es tut was es soll aber so überschwenglich begeistert wie Todd von What Do I Know bin ich nicht.

Ja, es hat drei visuelle Styles um die Programme zu starten aber keiner hat mich voll überzeugt, ich mag das unauffällige Erscheinungsbild von Launchbar. Vielleicht auch nur die Gewöhnung ;-)
Von der besseren Performance hab ich auch nicht viel gemerkt. Das Anzeigen dauert auf meinem iBook auf jeden Fall länger als bei Launchbar und die Startup-Zeit ist mir egal. Wer rebootet schon sein iBook? ;)

Der Hauptvorteil ist natürlich das es free ist, ganz klar. Die zusätzliche Features könnten auch ganz nützlich sein wenn man sie mal in den Workflow eingebunden hat. Aber ich bleibe erstmal bei Launchbar, die haben wenigstes ne informative Produkt-Seite.

QuickSilver – A Better OS X In Just 10 Minutes – noch ein kleines Tutorial da die Doku, sagen wir mal, etwas dürftig ist.

more rain expected in houstonThis game is problematic. Were it not for a last second shank by Vikes kicker Walsh, the Squawks might be at home watching the playoffs on TV this week. Week 6 the 15 1 Panthers had their coming out party overcoming a 9pt 4Q deficit on the road, accented by Newton hitting TE Olsen with under 34 seconds for a 26 yd TD to shock the 11 6 Squawks cheap oakleys 27 23 .Bobby Kennedy got involved in a messy sexual affair with Marilyn in the summer of 1962 when he was sent out to Los Angeles by his brother Jack to convince the screen goddess to stop calling the President at the Cheap NFL Jerseys White House. The President was not going to divorce Jackie and marry her.We bring up the cult sci fi series about a reincarnating time traveler because it’s currently missing 97 of its 800 episodes after the BBC had wiped the tapes containing them, in a foolish but noble effort to weaken the show’s fanatical fanbase, probably. It apparently didn’t work, though, because ever since then, BBC has been desperately scouring the globe for the lost episodes, some of which have turned up in attics, garage sales, far flung former parts of the British Empire cheap ray bans like Nigeria or Hong Kong, and the basement of a Mormon Church in London.NHL fake oakleys teams usually practice in the late morning. Injured players arrive early to receive treatments and do their rehabilitation work. Players assemble before the practice for individual, group or team meetings. They fuel up with nutritious snacks or energy drinks. They do dry land training to warm up. Practices tend to be fast paced and relatively short, with warm ups, intense team drills for cheap mlb jerseys about an hour, then a cool down period with some individual skill work. Players may do some off ice conditioning ray ban sunglasses work and perhaps receive additional treatments before heading out for lunch. As the season wears on, most coaches hold “optional skates” for players who haven’t played as much. They excuse the weary or injured players from on ice work. Teams often give players community outreach or public relations assignments on light work days or days off.In 2011, “Ricky L.” was in a league with a husband and wife, who were each managing their own teams. On Sunday of Week 11, the husband’s star running back, Fred Jackson, breaks a bone and is out for the season. Two days later, on Tuesday of that week . heartbreak. The wife suddenly and tragically passes away. Horrible, right? Just devastating. As Ricky recalls, “It was a very sad, awkward, and weird situation. We oakley sunglasses outlet all felt bad for the husband.”

Dev to Dev: James Duncan Davidson Interviews Panic [Mar. 23, 2004]

all blacks unlikely to visit wembley before openerStanford head coach David Shaw said: “We understand that this was a very difficult decision. For three years Christian has not only been a great player, but a great teammate as well. We wish him great success at the next level, as we continue our preparation for the Sun Bowl.” Former South Carolina running back Marcus Lattimore. We believe it is the only consumer product that is demonstrated statistically significant efficacy in mitigating muscle cramps in a rigorous double blinded scientific study. The beverage is low calorie, certified USDA organic, and has been certified for sport by NSF which tests more than 230 prohibited and banned substances and allows professional athletes to take the product.Goosey said Wing could provide training for Fevola’s sudden cheap jerseys interest in becoming an NFL star, while playing with the Dolphins. ”Brendan would be a good acquisition for the club and we’ve made a few calls and I’m just waiting cheap China Jerseys to talk to him and sit cheap football jerseys down and have a chat to him,” Goosey said. ”We’re a stand alone club and we’re not dictated by anyone else.”(Fig. 2i,j). LiCl, a catenin activator, significantly induced Wnt1 mRNA (Fig. 2k) and protein expressions (Fig. 2l) in cells cultured on the soft ECM, and diminished the difference in Wnt1 expression wholesale Jerseys between stiff and soft ECMs (Fig. 2l). These results suggest that the increase of Wnt1 expression on stiff substrate is mediated by catenin, which may be the upstream of Wnt1. The 4 player, or the power forward, they’re going to be doing a lot of rebounding. cheap nfl jerseys They’re going to take up a lot of lay ups or short stops from underneath the basket. Generally, they have to be a very strong player and a very physical player, because when you get cheap oakley sunglasses underneath the basket, there’s a lot of shoving that goes on. Vicki Starr Goes RogueBy the fall of 2003, Risperdal sales rep Vicki Starr was ready to quit. She had been working for Janssen in the Northwest region for a little over two years. During that time, her green manual full of sales material that at least devoted some attention to how the drug treated schizophrenia had been replaced, she says, by a “red binder full of material that directed the sales staff to sell to a full spectrum of symptoms that could be related to just hockey jerseys about any mental health condition.”That’s a lot of plays to consider that are questionable. It’s magnified when more than 100 million people are watching. And outside of Baltimore, fans of the game continue to have their faith shaken that the league will not do the right thing when it comes to perceived injustices. The last thing the NFL wants to discuss is its poor officiating.
(0)

Colloquy: IRC Client (via) – Mac OS X

What viewers, readers and Twitterers want when a big story is developing is constant, new updates. And perhaps most would accept and understand that this means the occasional slip up. Readers certainly indicate wholesale jerseys that they are ok with occasional inaccuracy when they continue to visit a site or follow a news outlets Twitter feed even after they misreport something.. ”I don’t think so. I think it’s too centrally cheap oakleys controlled. cheap nfl jerseys It’s not a free market. Thanks Stephanie. Good morning everyone and welcome to L Brands Second Quarter Earnings conference call for the period ending Saturday, August 2, 2014. As a matter of formality, I need to remind you that any forward looking statements we may make today are subject to our Safe Harbor statement found in our SEC filings. T Tau and P Tau levels in mouse serum were measured post mTBI using the ultra sensitive immunoassay platform Enhanced Immunoassay using Multi Arrayed Fiberoptics (EIMAF) in combination with rolling circle amplification (a EIMAF). Mice were subjected to rmCHI and followed by a EIMAF assay over a 30 day period during which changes in serum levels of T Tau and P Tau were determined. At each time point, serum was collected from separate groups each consisting of 5 8 mice and serum samples were analyzed individually in triplicate, in a blinded fashion. Children need to be active for optimal health, but many are leading sedentary lifestyles due to TV, computers, video games and the lack of physical education in many schools. You can swap your child TV time for a fun 60 minutes of physical activity every day and help to protect them from childhood obesity, high blood pressure, type 2 diabetes and high cholesterol, according to The American Heart Association. Workouts for children should meet the needs of their developmental stage, notes the American Council on Exercise. When you at home and don feel like going to the gym use Ab Lounger. Put on some music and cheap nfl jerseys the time will fly by. You can exercise while you are watching your favorite TV shows. Now at 4 6, Jacksonville are somehow back in the play off race. Whilst their record virtually puts them out of the running for a wild card spot, the ineptitude of their fellow AFC South opponents has provided some hope. Indianapolis continues to lead the division but only with one game in hand at 5 5. Hodor, the Game Of Thrones character with immense strength and incredibly insecure passwords, is portrayed by actor cheap oakleys Kristian Nairn. In real life, Nairn isn’t a child toting simpleton. OK. Exactly double the number of people ray bans sale obliged her when she asked on their right. In a dating situation, not only could the chances of someone saying yes to wholesale football jerseys china a date hinge on who is standing where, but the emotional aspect could come into play as well. Sure, you might agree to go out with someone who talked in your left ear, but your first impression might be to associate him with more negative emotions..
(0)

Holbrook: rsync: one of the wonders of the CS world – kann man immer mal brauchen

Tonight at least, it’ll be very disorienting for the Thunder when they take the court against Houston for game 3 of their series. In five years, he has played every game 439 straight games. He’s now going to miss number 440.. This can happen with any damage to the knee, sudden twist or trauma. It happens typically during any rigorous sports activity that has sudden stops, turns and twists like movements. Age also causes the meniscus to tear. “It’s critical in this day and age to have a relationship with your fan base,” said Steve Bornstein, president and chief executive of NFL Network. “It’s in the best interest, not only of our fans, but for the NFL, to have a direct consumer cheap jordans online relationship. Much of what we do in the digital space is trying to enhance that.”. This is one of the most painful injuries that an athlete can endure and it almost always happens in the middle of a sporting event. This is normally an injury that occurs when an athlete has pushed himself past his limits. It is a frequent track and field injury and it also happens quite a bit on the football field. Setting a specific duration of time to diet can motivate you to cheap nba jerseys remain disciplined in order to reach your goal. Four weeks is a long enough period for you to establish healthy habits while also seeing results for your efforts. A number of factors go into determining how much weight you can lose in four weeks; combine healthy lifestyle habits with a wholesale nfl jerseys sound diet and exercise program to see the best results.. Begin your preparations early. Football practice in the week leading up to a football match is an important factor in match preparation for players and coaches alike. Practice should work on the physical fitness of a football player, while also developing the technical and tactical ability of each player and the team as a whole. Be realistic, try not to take things too literally, slow yourself down and manage your stress levels and emotions effectively. Find other outlets for them other than indulging in food and drink. The bottom line is if you want to maintain a healthy lifestyle and avoid holiday weight gain find opportunities with the season to find inspiration in holiday weight loss tips. The feeling was mutual. “I would love to take credit for it but I think Rory beat three guys today in foursomes,” Garcia said. “It’s not easy to do. If Colin wholesale nfl jerseys Kaepernick really wanted to make a difference, he could speak out against the epidemic of father less homes in cheap nfl jerseys the black community. An epidemic that is almost solely responsible for all the problems that Kaepernick is blaming on “racist” America. Colin was given opportunities that many young black men do not have today because of the lack of a father figure in their home..
(0)

the archives of the forty-second parallel :: It Kills Me (via) – über die viel zu große Auswahl bei Python Web-Frameworks

david cameron too close to rupert murdochThere are two main methods. Either the varicose vein is disconnected and ‘tied off’ so that the blood is diverted through healthier veins. Alternatively, if the vein is very large and distended, it may be removed altogether through an incision in the groin, a process known as ‘stripping’. Although it sounds alarming, the surgery is normally done as an outpatient and recovery takes only a matter of days.Sometimes it only takes one cameo to tell a story. Adam Lallana, cast into the cauldron of a Merseyside derby cheap oakleys for only his second Anfield start, gestured to the space he needed the Italian to run into as they broke into a second half counter attack. Balotelli adhered to the command, reached the designated space and promptly fell over.Hi, my name’s Joe at the Break Time Billiards, Wilmington, North Carolina. And today, we’re going to talk about how to rack nine ball. Nine ball’s played with nine balls, and when you rack them, you put the one in the front and nine in the center. And some tournaments require that you put the two ball at the back. You will go ahead and push the balls forward by taking your hands, placing them in the holes that are left in the rack, and push forward with your thumbs using your hands to hold the back two balls. Once you’ve got the ball over the spot, you then can take and remove the rack and you have a rack of nine balls. Now, some tournaments play to where you have to rack the nine over the spot. In that fake ray bans case, you would push it forward to this position with the nine on the spot, and that would be the rack that you have. So a lot of times, as to where you put them in relation to the spot and where you put the two ball is determined by what particular tournament you’re playing in. But the general rule is the one in the front, the nine in the middle, put the Fake Oakleys one on the spot, take your rack away, you’re ready to play.That turned a fourth and 21 incompletion into a fresh set of downs for Netwon.”All I did wastry to jam him I think oakley outlet he knocked my hand up and I probably grazed his mask when he knocked cheap jerseys my hand up,” cheap oakleys sunglasses Harris said. “Inever grabbed his face mask.”After reaching the Broncos’ 32, Gano came on for the make or break kick. And I say 10 or 11 because in Texas, for instance, big state, one of their there was a decision that it can’t be done. One of the states is a one of the sites is abiding by that decision, one isn’t. So what I’m saying, what this all adds up to, is a pretty chaotic situation, more chaotic than the billion dollar valuation that was put on these cheap jerseys companies.
(0)

WinFS 101: Introducing the New Windows File System (via)

After his team arrived in Arizona on Jan. 26, Patriots owner Robert Kraft unexpectedly addressed reporters. He expressed how he was “disappointed in the way this entire Cheap china Jerseys matter has been handled and reported upon.” During his remarks, he threw his full replica oakleys support behind Brady and Belichick. He also let the NFL know that he wants and apology should their be no evidence of wrongdoing found.Earlier this year, the “Sunday Blitz” noted the failure of the team’s brass to draft and develop a wholesale nfl jerseys viable pass rush threat, and to have to rely instead on trade and free agency to supply rushmen. So far this season, the offensive line should merit the same kind of scrutiny. There have been some nettlesome constants with the Falcons the injuries, “red zone” and third down conversion failures, not finishing drives or winning close games but the problems on the offensive line might trump them NFL Jerseys Cheap all. And, frankly, are likely responsible for cheap oakleys sunglasses some of the shortcomings. Dimitroff and Smith made a conscious decision to release right tackle Tyson Clabo and to not try to talk center Todd McClure out of retirement, the way they did tight end Tony Gonzalez. McClure suggested this week that he would have come back for a 15th season, but that he was nudged toward retirement, as the team opted to go with younger players on the line.Rock and Roll had been initiated in the 1950s with artists like Chuck Berry, Elvis Presley, Jerry Lee Lewis and Little Richard who the Beatles idolized and emulated. The Beatles however, put a new sound and look to Rock and Roll and from that point it and music as a whole was never the same.The one mile race is a great test of not only your cardiovascular endurance but also your strength endurance as well. Getting off at a great start, maximizing the efficiency of your runs, but utilizing your techniques propel you from the start to the finish. Maintaining a good relaxed running form with elbows in, tied to the side, hands open relaxed to again minimize your energy expenditure, not grasping or clinching the fist or tightening up the upper body. To readers of Michael Lewis’ 2006 book The Blind Side: Evolution Of A Game, Michael Oher now an offensive tackle for the Baltimore Ravens, once a kid with a crack addicted mother ray ban sunglasses living in public housing in Memphis likely seemed deeply enigmatic. He didn’t talk much and he didn’t want to rehash his past, Cheap Football Jerseys so he just . didn’t.Fox was fined $30,000 and Del Rio was fined $25,000. As Bill reported for us, that game on Monday was a kind of culmination of frustration with the job of replacement officials. The league locked out the regular officials in the course of contract negotiations and the NFL says it may use replacement officials for the first five weeks of the season.
(0)

An Introduction to Generics in Java (via)

Hi, I’m Mike Lawrence with AAG Golf Group and TGM Golf Academy here in upstate South Carolina, and today I want to show you some drills on how to shorten your backswing. Keeping a good connection between our arms and our body is very important cheap nfl jerseys in the golf swing. That simply means that as we make the golf swing, the swing is going to seem short to us and it should seem short. Not that Garcia is really complaining. He and his fianc Linda Antonsson have served as unofficial consultants on the television series and are finishing work on The World of Ice and Fire, a companion book to the novels, due out later cheap nfl jerseys this year. “It’s certainly true that the show is booming in popularity,” he says. “It’s at that point in zeitgeist where it seems as though everyone is talking about it.”Technologie Standards zu erf llen und Administratoren helfen eV , ?hm positive Ver ? nderungen in ihrer Schulsysteme Machen . Mit H?hle oben genannten Anmeldeinformationen k ? Nnen SIE Familienmitglieder Leben . Life Insurance f ? Rdert UnternehmerTUM das. Weil Menschen sterben Nicht F rchten Das Risiko von roshe runs aus Kreativit ? T , ? Sthetik , Gleichgewicht , Farbe, Harmonie und Einpr ? Gsamkeit . Besucher FINDEN Eine Hervorragende Bilanz Bereich zwischen nike roshe run men Effizienz und Erschwinglichkeit Markt auf Blue ja , vielleicht. Aber was, wenn er sie nicht gesagt, dass es morgen? Es sollte ein free run 5.0 secretand eine berraschung sein , und ist ein Mann ein Recht auf sein eigenes Engagement ruhig zu halten bekam , hat er nicht? Wir nike air huarache wouldn bekannt , wenn Fr?ulein Melly Tante nicht lassen Sie es aus . Warum haben wir es seit nike huarache triple black Jahren bekannt. Die Wilkes und Hamiltons alwaysmarry ihre eigenen Cousins. Jeder wusste, dass er wahrscheinlich heiraten eines Tages, wie HoneyWilkes wird cheap nfl jerseys sich Fr?ulein Melly Bruder , Charles zu heiraten. dann , vor etwa einer halben Stunde , bekam sie Art von Ruhe, wie white huaraches sie Kopfschmerzen hatte . The Air Jordan 1 has been one of the most popular sneakers of the past 2 years. It originally released in 1985, returned to little fanfare in 2001 and exploded back on the scene in 2013. Now one has to back up the Brinks truck to secure a pair in deadstock condition.Beats audio gucci outlet levi jeans christian louboutin outlet hilfiger online shop juicy couture rolex watches rolex watches the north face michael kors outlet new balance tiffany jewelry p90 replica handbags ralph lauren polo ralph lauren ugg australia louis vuitton taschen louis vuitton outlet jordan release dates 2015 salvatore ferragamo bcbg max ugg boots oakley sunglasses kate spade ralph lauren outlet online louis vuitton mont Baratas Ray Ban blanc pens gucci outlet swarovski uk prada handbags harrods longchamp taschen mcm handbags handbags outlet rolex watches new balance outlet supra shoes michael kors outlet rolex michael kors purses ralph lauren polo outlet straightener louboutin coco chanel louboutin outlet nike air force swarovski crystal vans store louis vuitton outlet burberry outlet gucci sale michael kors cheap moncler jackets tory burch sandals hollister toms shoes barbour jackets sale uggs vans schuhe chanel sunglasses replica watches swarovski jewelry coach outlet nike schoenen new balance longchamp handbags beats audio true religion outlet burberry outlet louis vuitton burberry online shop swarovski gucci handbags nike air max uhren shop ray ban burberry outlet michael kors toms shoes louis vuitton beats audio tory burch sandals polo ralph lauren retro jordans tommy hilfiger online michael kors outlet online louboutin shoes puma online shop oakley canada retro jordans hollister clothing cheap nhl jerseys swarovski canada coach factory outlet online michael kors outlet ray ban sunglasses ray oakley outlet ban sunglasses oakley sunglasses purses and handbags reebok ferragamo oakley sunglasses nike air max north face tommy hilfiger outlet reloj uggs outlet michael kors tory burch sandals burberry outlet online pandora jewelry ralph lauren nfl jerseys cheap true religion mercurial superfly michael kors nike huarache abercrombie fake Oakleys fitch longchamp outlet michael kors outlet michael kors outlet online coach factory outlet jordan release dates 2015 cheap jerseys cheap jordan shoes lululemon north face celine bags polo ralph lauren outlet tory burch sale.
(0)

CSS Refactoring

Mar 2004
22

So toll CSS ja auch ist, bei umfangreichen Styles für viele verschiedene Seiten stösst es auch an Grenzen. Mein Stylesheet ist jetzt 9KB groß und man verliert doch sehr schnell die Übersicht. Ein Konzept um das besser zu strukturieren wäre da hilfreich, momentan helfe ich mir halt mit (hoffentlich) guten Bezeichnern und Kommentaren im CSS.

Deswegen habe ich auch – nachdem ich mit dem Design jetzt erstmal fertig bin – mein Stylesheet einem Refactoring unterzogen. Logisch geordnet, Kommentare geschrieben und versucht Redundantes und nicht Benötigtes rauszuschmeissen. Sehr hilfreich und erstmals richtig von mir verstanden ist die Verwendung von Selektoren, damit man nicht in die classitis kommt.

Eine Sache die ich nicht richtig entscheiden konnte ist die Verwendung von einem CSS-Block für mehrere verschiedene Elemente:

.post .meta, .post .meta A,
.left a, .right a,
.archive a, li.arch-day a {
   color: #ccf;
   font-weight: normal;
   letter-spacing: 0;
   text-decoration: none;
   border: none;
}

Als ewiger Optimierer finde ich das natürlich gut *g*, aber zu einer besseren Übersichtlichkeit und Wartbarkeit führt das nicht gerade.

Yesterday, the New York Times reported on a study that found that former professional football players run a higher risk of Alzheimer’s or dementia related illness. The study was commissioned by the National Football League and surveyed more than a thousand retired players. The NFL itself and others raised questions about the way the study was conducted. More on that in just a minute.In my analysis of 2016, I’ve tried my best to make relevant distinctions between Sanders and Clinton. In my recent appearances on Ring of Fire and The Benjamin Dixon Show, I highlight why Clinton had essentially been a Republican on issues ranging from war and foreign policy to gay marriage, Keystone XL, the TPP, and other topics. As for my views on foreign policy, I’ve also appeared on Ring of Fire to discuss my thoughts on Dick Cheney and Jeb Bush.Every coach gets excited about seeing a freshman become a junior, looking back on when he was a freshman when he couldn’t do half the things Cheap NFL Authentic Jerseys you wanted him to do. And then ray ban sunglasses over the course of a couple years of practice and work and commitment, you see him evolve into a really good football player and you know that you had some cheap oakley sunglasses effect on that. I mean, that’s awesome. But it pales in comparison Cheap nfl jerseys to watching a kid who was in jail and in a gang, get out of a gang, drop the jail mentality and go to college. That’s a whole different level of mentoring and coaching and teaching, and that’s also a more lifelong, profound effect that you can have on a human being. I miss that. And one day I hope to return to it. But that cant take precedent over my own children and my own family anymore.First, football champions go through incredibly thorough preparation. During the off season, athletes discipline themselves to stay in top physical condition. Once the season opens, a winning team will follow a strict exercise regimen, nutritional diet, and scrimmages under game conditions. Alabama legendary Coach Paul Bryant hired referees to observe his team practice, and throw penalty flags as they would do in a real cheap nhl jerseys game.If you hear someone behind shouting “first down” at Twickenham tomorrow it will probably just be Jack Bechta confused in all the excitement.Bechta is an American football agent in England to scout talent at the Rugby World Cup. wholesale jerseys Rugby is advised to take him seriously. For Bechta is the man who has transplanted Jarryd Hayne from the league side Parramatta Eels to the San Francisco 49ers and has done so in five wholesale jerseys months.Bechta made this fantastical switch a reality; and not just as a place kicker as Paul Thorburn believed was possible in the 90s, but as an actual player as a running back in Hayne’s case, who appeared in the 49ers’ seasonal opener on Monday.

TypeKey? You Blow Me

Mar 2004
22

TypeKey is centralized, so obviously lots of people who run their own weblogs are against it. It’s not open source, so obviously lots of un-American bastards who run open source software are against it. And it’s not from Dave Winer, so obviously Dave Winer is against it. I am reflexively in favor of anything Dave Winer is against. But let’s look at the facts before we jump to conclusions. After all, this is the blogosphere, and we’re known for that.

Aus TypeKey? You Blow Me [dive into mark], komplette und geniale Schilderung der Lage ;-)

The single stranded cDNA was added to the gene specific primer mix and SYBR GREEN PCR Master Mix (Applied Biosystems). Gene specific primers were as follows: Gabrb1: 5′ CGGAAAAGGCCCTCAGAAA (sense) and 5′ GCATCAACCTGGACTTTGTTCA (antisense); Gapdh: 5′ GGCCTACATGGCCTCCAA (sense) and 5′ GCCTCTCTCTTGCTCTCAGTATCC (antisense); Knca1: 5′ GCAATCAAAAGCCCCCAAAC (sense) and 5′ CCACCCCCCAAATTCACAA (antisense); Opkr1: 5′ GCACATGTCCTGGCAACAATAC (sense) and 5′ GATGGAGGTGCAGTAAATCGA (antisense); Slc18a3: 5′ CACCAGTCCTTCTTCTTTTGCG (sense) and 5′ GCGGTTCATCAAGCAACACA (antisense); Sst: 5′ AAGCTGGCTGCAAGAACTTCT (sense) and 5′ AGAGGTCTGGCTGAGACAACAA (antisense). PCR reactions were performed on the Applied Biosystems 7000 system in the Real Time Core Facility at the Stokes Research Institute. There is one issue, however. Few Haitians would be able to afford the price of admission to an NFL game. But, hey, we could resolve that by flying in planeloads of wealthy Americans to each of their eight home games. Tracy Wolfson of CBS Sports was on the sidelines for that game, and she’s on the line now. Hi, Tracy. Thanks for joining us.. It’s no surprise that there was heavy drug use during the Vietnam war. Being in the center of a brutal conflict seemingly without end while surrounded on all sides by naturally growing pot and heroin will do that to you. But it was a little trickier to get your hands on the paraphernalia with which to get high. The only guy returning this year who carried the ball last season is Kerryon Johnson, who has talent, but after an offseason surgery, can he carry the workload? Behind Johnson, Auburn has converted H back, Kamryn Pettaway, and two freshmen, Malik Miller and Kam Martin. That doesn’t mean Auburn can’t find a running game, and they’ll have to if they want to beat Clemson. Whether it comes from the quarterback position or from one of these guys, Auburn musts run the ball to keep the pressure off whoever does end up starting fake ray ban sunglasses at quarterback.. It was strong. And according to Benjamin Franklin and others it was a thief and should not even be considered to represent the country. He wanted the noble oakley outlet turkey who was honorable, smart, and beautiful to be the emblem. I think investors will move on from these worries in 2017. The company’s purchase of Meda in 2016 fake oakleys gives it an expanded footprint in cheap jerseys Europe and important emerging markets like Russia. In addition, EpiPen sales will account for less than 10% of overall hockey jerseys revenue in the New Year. Very interesting piece. I must say I enjoyed reading it because for one thing it’s true. Coast Guard as one of the thousands of Filipino citizens to replace the blacks as Wholesale Jerseys stewards. This is important because it’s the FBI’s job to deal cheap ray bans with domestic terrorism, including all those right wing militias, and they can only do their job if people on the extreme right trust them . Which now that I think about it, sounds like one of the really crappy episodes of Heroes back when it first started to dip into “this sucks” territory. Daryl Johnson, a former Homeland Security analyst who specialized in the militia movement, pointed out that “militia members turning on other militia members” is how the FBI gets a ton of its information.

Cygwin rxvt

Mar 2004
22

Ein guter Tipp für Cygwin der das ganze noch ne ganze Ecke brauchbarer macht ist anstatt der normalen Dos-Box nen richtigen Terminal-Emulator zu nehmen. In dem Fall rxvt. Einfach das rxvt-Paket beim Cygwin-Setup auswählen und man bekommt ein für Windows kompiliertes rxvt, was etwas drollig aussieht ;-)

Funktioniert aber um Längen besser, vorallem was Copy&Paste angeht. Das ist mit der normalen DOS-Box nämlich fast nicht möglich. Mit rxvt geht das wie man es von z.B. Putty gewohnt ist mit Strg-Einfg und Shift-Einfg und die Welt ist wieder ein bisschen besser geworden ;-) Aber auch selektieren mit der Maus und das Scrollrad funktioniert.

Um rxvt dann aufzurufen macht man nen Shortcut dem man dann ne ganze Menge an Konfigurations-Parametern mitgeben kann (die man der rxvt manpage entnehmen kann). Der sieht dann bei mir so aus:

C:\Develop\cygwin\bin\rxvt.exe -g 100x40 -bg black -fg grey -fn
"Lucida Console-14" -T Shell -sr -tn ansi -ls -e bash --login -i
1b nfl concussion settlement in placeHealthy fats also improve our body blood sugar levels and the absorption of some nutrients. Plus, they just taste better. After all, they learned from the best. Just seven years ago, the Altria Group (the company once known as Philip Morris) still owned Kraft Foods. And they are using many of the same tactics, such as lobbying politicians and sponsoring favorable research to establish an image of their products as nutritious. New York spent early and often in free agency, breaking recent form as general manager Jerry Reese sensed Cheap Ray Ban Sunglasses heat from the top to flip the Giants’ fortunes on the field. Defensive end Olivier Vernon cashed in to the tune of $52.5 million and cornerback Janoris Jenkins is being paid like a No. 1 cornerback just for matchups like Sunday.Bironas was taken to the Vanderbilt University Medical Center where he was later pronounced dead. According to the report, there were no signs of drugs and alcohol in Bironas system. “Terry will not appear on today’s edition of FOX NFL SUNDAY,” Fox’s vice president of communications Dan Bell said in a statement. “He flew to Nashville early this morning to be with his daughter Rachel during this tremendously difficult time. The entire FOX Sports family has Terry, Rachel, the Bironas and Bradshaw families in our thoughts and prayers.”There wouldn’t be a chance of TAC getting within 100 points of the Big Three now.”At the big schools, the old school replica oakleys tie brigade can’t handle not having a crack 1st XV. It’s vital for their prospectus, their marketing and sponsorship. It’s driving a wedge between grassroots rugby and the upper echelon. The size of the user base and users’ level of engagement are critical to Twitter’s success. It had 320M average MAUs in the three months ended December 31, 2015, representing a 9% increase from 292M average MAUs in the three months ended December 31, 2014, and flat versus the three months ended September wholesale jerseys 30, 2015.If you purchase tickets, you can’t re sell them. The account holder who purchased the tickets must be present to enter the grounds of Augusta National. Another important hockey jerseys thing to know before heading to the club is that you’ll go through a security screening process more intense than at airports. Cell phones, cameras and electronic devices aren’t allowed on the grounds, neither are large bags, including purses. Small purses and bags to carry items such as sunscreen cheap jerseys and keys are allowed but will be searched. The only exception to these prohibitions: cameras are allowed during practice rounds, but not cell phone cameras. Augusta National strictly forbids cell phones. You’ll be booted from the grounds if caught with one, so leave your mobile device in the car or at the hotel.

MacDevCenter.com: Panther, Python, and CoreGraphics

most challenging ‘season’ just beginningAmerica’s Everything Pak is for those TV maniacs that can’t live without TV entertainments. This package is the ultimate of the Dish Network that provides every TV channels available under the sun, premium movie channels are included here in this package: Showtime Unlimited, HBO The Works, Multimax from nfl jerseys cheap Cinemax, and Starz Encore Super Pak. You will get more than 2000 movies per month with America’s Everything Pak.Airport security procedures usually call for e ticket flyers to present government issued photo identification to claim their ticket and receive a boarding pass. (International travelers: Don’t forget your passport and/or visa.) In some cases, other documents or the credit/debit card used to make the online purchase may be required. Passengers should check with individual airlines for appropriate documentation requirements. It is recommended that passengers arrive and check in at the airport either at the airline counter or a self serve kiosk, if available at least one hour prior to your flight. This allows time to iron out any last minute issues. However, some e ticket holders can check in for their flight from their home computer.It is rare that you will play in a single deck blackjack game. The next step is to calculate the “True Count.” The true count is calculated by dividing the running count by the total number of decks that have not yet been dealt. The most common, and easiest, way to cheap jerseys wholesale determine how many decks are left is to look at the remaining cards in the shoe and make an estimate. The increase at worldwide Disney channels was due to higher affiliate revenue at domestic channel and higher advertising revenue at international channels, partially offset by higher programming costs. The increase at ABC Family was driven by higher affiliate and advertising revenues reflecting an increase in units sold. At Interactive, operating income increased 36% in the quarter driven cheap MLB Jerseys by higher results from our mobile gaming business due to the continued Wholesale NFL Jerseys success of Tsum Tsum as well as lower product development costs, partially offset by lower results at our console games business. Lower console game performance reflected higher producing costs, driven by Disney Infinity, lower unit sales throwback jerseys and higher marketing costs. The decrease in unit sales was driven by lower sales of catalog titles and Disney Infinity figures, partially offset by higher sales of Disney Infinity starter packs.My first trip to India was a giant walkabout. I went with a plastic shoulder bag the size of an airplane pillow. The goal was well, there were a few of them. One was to see Hinduism in action1. The other was to clear my head and get my act together. I wanted to get some thinking done. For some reason, I thought India would be the place to do it.
(0)